JRI Journal of Reproduction and Infertility 2228-5482 2251-676X Avicenna Research Institute JRI-11-33 Original Article Association of Vascular Endothelial Growth Factor (VEGF) +405 G>C Polymorphism with Endometriosis in an Iranian Population Memariani Toktam B.Sc 1 Salimi Nejad Kioomars M.Sc 1 Kamali Kourosh M.D., M.P.H 1 5 Shervin Adel M.D 2 Mohajer-Maghari Behrokh M.Sc 1 Akhondi Mohhamad Mehdi Ph.D 1 3 Khorram Khorshid Hamid Reza M.D., M.P.H., Ph.D 1 4 * Reproductive Biotechnology Research Center, Avicenna Research Institute, ACECR, Tehran, Iran Gynecological Surgery Ward, Tehran Clinic Hospital, Tehran, Iran Avicenna Infertility Clinic, Avicenna Research Institute, ACECR, Tehran, Iran Genetic Research Center, Social Welfare and Rehabilitation Sciences University, Tehran, Iran Department of Epidemiology and Biostatistics, Faculty of Public Health, Tehran University of Medical Sciences, Tehran, Iran Corresponding Author: Dr. Hamid Reza Khorram Khorshid, Reproductive Biotechnology Research Center, Avicenna Research Institute (ARI), ACECR, Shahid Beheshti University, Velenjak, P.O. Box: 19615-1177, Tehran, Iran. E-mail: h.korramkhorshid@avicenna.ac.ir Apr-Jun 2010 11 1 33 37 19 12 2009 03 02 2010 Copyright © 2010 Avicenna Research Institute 2010

This work is licensed under a Creative Commons Attribution-NonCommercial 3.0 Unported License which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly.

Introduction

Angiogenesis, growth of new blood vessels from pre-existing vessels, is a crucial physiological process for tissue regeneration. This state is also seen in pathological processes such as malignancies and endometriosis. Vascular endothelial growth factor (VEGF) is a major mediator of angiogenesis and vascular permeability which is known to play an important role in the development of endometriosis. The aim of this study was to investigate the relationship between +405 G>C VEGF polymorphism and endometriosis in an Iranian population.

Materials and Methods

The study population was comprised of 105 women with and 150 women without laparoscopic evidence of endometriosis. Genomic DNA from blood cells was extracted using salting out method. Genotype and allele frequency of +405 G>C polymorphism was compared between women with endometriosis and the controls using PCR-RFLP. Statistical analysis was performed using SPSS 13.0 software. Chi-squared test and odds ratio plus 95% confidence interval were determined. A p-value less than 0.05 was considered statistically significant.

Results

While the +405 VEGF genotype frequencies in the case group were 41.3% G/G, 46.2% C/G and %12.5 C/C, they were 32% GG, %53.3 GC and 14.7% CC in the control group. The distribution of three genotypes and allele frequencies of +405 G>C VEGF polymorphism between the case and control groups did not demonstrate any significant difference.

Conclusion

In contrast to previous studies, no significant correlation was found between +405 G>C VEGF polymorphism and endometriosis. Since this was the first study in an Iranian population, further investigation with bigger sample sizes may be indicated to be able to generalize the findings.

Angiogenesis Endometriosis Polymorphism Vascular endothelial growth factor

To cite this article: Memariani T, Salimi Nejad K, Kamali K, Shervin A, Mohajer-Maghari B, Akhondi MA, et al. Association of Vascular Endothelial Growth Factor (VEGF) +405 C>G Polymorphism with Endometriosis in an Iranian Population. J Reprod Infertil. 2010;11(1): 33-37.

Introduction

Endometriosis is defined as the growth of endometrial tissue including endometrial glands and stroma outside the uterine cavity, causing diverse diseases and signs such as infertility, pelvic pain, and dysmenorrhea (1, 2). Depending on the diagnostic method, the prevalence of this disease during reproductive period is reported to be 5 - 10% in the general population. The frequency of this disease among women who visit gynecologists for fallopian tube obstruction varies between 1 - 7% and in infertile women it varies between 9 - 50% (3, 4).

Although, this disease has been described and diagnosed for more than 100 years now, the mechanisms underlying the development of the disease are still unclear. While the transplantation of endometrial tissue into the pelvic peritoneum via retrograde menstruation is considered as one of the most widely accepted explanation for the pathogenesis of the disease, this physiological process does not lead to the onset of the disease in the majority of cases. Therefore, diverse factors are thought to be involved in the development of the disease, such as environmental, immunological, endocrine and genetic predispositions (5).

Angiogenesis is known to play a key role in the implantation and growth of the endometrial tissue displaced by retrograde menstruation (6, 7). Endo-metriotic lesions with high proliferative activity have a higher microvessel density compared to lesions with low proliferative activity (8).

Vascular Endothelial Growth Factor (VEGF) is a heparin-binding glycoprotein which is known as one of the strongest factors with angiogenesis properties (6). This glycoprotein plays a fundamental role in regulating angiogenesis and vascular permeability in both physiological and pathological states (9). There are many reasons indicating the role of VEGF in the development of endometriosis, such as expression of VEGF in stromal and epithelial cells and its regulation by estrogen (10, 11). Comparison of endometrial epithelial cells in patients suffering from endo-metriosis with healthy subjects shows higher levels of VEGF, specifically at the end of the secretory phase of menstrual cycle, and these cells are found more in red than black endometriotic lesions (12, 13). Furthermore, peritoneal cavity fluid in patients with endometriosis shows significantly elevated levels of VEGF compared to that of controls (6, 14, 15). VEGF is also considered as a diagnostic tool and candidate gene for the diagnosis of endometriosis. Based on genetic association studies, a few mutations and single nucleotide polymorphisms (SNPs) found in VEGF gene are regarded functionally important. For example, +405 G>C polymorphism in 5’ untranslated region affects the level of VEGF protein expression (16, 17).

Numerous studies have reported that VEGF gene polymorphisms are associated with prostate cancer, development of proliferative diabetic retinopathy and decreased risk of breast cancer (1820).

Recently, the association of -460 C>T VEGF gene polymorphism with endometriosis was demonstrated (21). Furthermore, three research groups which have investigated the existence of any association between endometriosis and +405 G>C polymorphism in Chinese (21), South Indians (5) and Korean women (2), have reported positive findings, but to date, these results have not been confirmed in other populations.

In the present study, the correlation of VEGF gene +405 G>C polymorphism with endo-metriosis in an Iranian population was assessed.

Materials and Methods Patients

To assess +405 G>C VEGF gene polymorphism, blood samples were collected from 20 – 50-year old women, who had been referred to Avicenna Infertility Clinic and Tehran Clinic Hospital in Tehran, Iran. One-hundred and five patients with endometriosis and 150 women with no gynecological problems were selected as cases and controls, respectively. The diagnosis of endometriosis was confirmed by laparoscopy.

Women having rheumatoid arthritis, giant cell arthritis, diabetic retinopathy, psoriasis and Behçet's disease were excluded from the study. The protocol of the study was also approved by the Ethics Committee of Avicenna Research Institute. A written informed consent was obtained from all the participants.

Genomic DNA Analysis

Five milliliters of peripheral blood samples were collected in tubes containing 200 µl of 0.5 M EDTA. Genomic DNA was extracted from the obtained blood samples using the salting-out method.

Genotyping of the 405 G>C polymorphisms in VEGF gene was determined by employing PCR / RFLP method. One pair of primers (Forward: 5' CCACTTGAATCGGGCCGACG 3', Reverse: 5' GTCTGTCTGTCTGTCCGTCA 3') was used to amplify the relevant fragment and analyze the +405 C>G variation. Each PCR reaction with a total volume of 25 µl, contained 50 ng of genomic DNA, 5 pmol of each primer, 1.5 mM of MgCl2 (Roche, Germany) and one unit of DNA polymerase (Roche, Germany). Amplification was performed in a programmable thermal cycler gradient PCR system (Eppendorf, Germany). DNA was denatured at 94° C for 5 minutes. The PCR amplification was carried out for 30 cycles (denaturation at 94° C for 30 sec, annealing at 61° C for 30 sec, extension at 72° C for 30 sec and final extension for 7 min at 72° C).

The PCR products, harboring the polymorphism at 5’ UTR of VEGF gene were analyzed using 1.5% agarose gel electrophoresis followed by ethidium bromide staining and ultraviolet visualization. The PCR products were digested with restriction enzyme BsmFI (New England Biolabs, UK) at 65° C overnight for +405 C>G Polymorphism, separated by polyacrylamide gel electrophoresis, and identified using silver nitrate staining. The +405 G allele was cut into two fragments of 101 and 181 bp, while the +405 C allele remained uncut (282 bp) (Figure 1).

Restriction digestion of PCR products demonstrating the patterns of digestion in different genotypes of VEGF +405 G>C Polymorphism. M: Marker VIII (Roche), 1: Homozygote (variant), 3: Heterozygote (variant and wild type), 5: Homozygote (wild type), 2, 4 and 6: PCR product

Statistical analysis

According to the restriction digestion pattern and gel staining analysis, genotypes of the participants were divided into three groups based on the presence or absence of polymorphism: wild-type homozygote, variant homozygote and heterozygote DNAs.

Statistical analysis was performed using SPSS statistical package (V. 13.0). Allele ratios and genotype distributions in the cases and controls were analyzed by logistic regression. GG genotype and G alleles were assumed as reference group in the analysis using Pearson's Chi-square exact test. Odds ratios were calculated with 95% confidence intervals (CIs). P-values less than 0.05 were considered statistically significant.

Results

The +405 VEGF genotype frequencies in the case group were as follows: 41.3% G/G, 46.2% C/G and %12.5 C/C representing 43, 48 and 13 patients respectively. The genotype frequencies in the control group were 32% GG, %53.3 GC and 14.7% CC in 48, 80 and 22 patients, respectively. There were no statistically significant differences between the cases and controls in terms of 405 G/C genotype distributions and allele frequencies (p = 0.267), Table 1.

The distribution of genotype and allele frequencies in the studied groups

Genotype/Allele Study Group P-value OR

Patients (Number) Controls (Number)
Genotype
  GG 48 83 Reference Group
  GC 80 48 0.150 0.67 (0.39 - 1.15)
  CC 22 13 0.308 0.66 (0.3 - 1.47)
Allele
  G 133 176 Reference Group
  C 75 124 0.267 0.8 (0.55 - 1.17)
Discussion

A key mediator in angiogenesis is vascular endothelial growth factor, as it stimulates endothelial cell proliferation and migration and increases vascular permeability. Recent studies have shown the association of VEGF gene polymorphisms with the development of diseases in which angiogenesis plays an important role. In the present study, the possible correlation between endometriosis and +405 G>C VEGF gene Polymorphism was studied in an Iranian population.

Awata et al. showed that +405 C/C VEGF gene polymorphism versus G/G genotype in type II diabetes mellitus increases the possibility of retinopathy of about three folds (22). Patients with psoriasis showed a significant increase in the frequency of C allele and +405 C/C genotype of VEGF gene compared to healthy controls (23).

VEGF gene is located on chromosome 6p21.3. This gene consists of 8 exons and the gene transcript undergoes alternative splicing processes to produce a protein family (24). There are a few transcription factor binding sites in 5’ untranslated region in VEGF gene (25). Hence, polymorphisms in this region result in different levels of gene expression in people, causing various ranges of diseases.

Three separate research groups carried out case-control studies on various populations to determine the association between endometriosis and +405 G>C VEGF gene polymorphism. Watson et al showed that the G allele at +405 possibly resided within a potential myeloid zinc finger protein (MZF1) binding site and had direct effects on the level of gene transcription and ultimately on LPS-stimulated VEGF protein expression in peripheral blood mononuclear cells (PBMCs) (17).

Bhanoori et al. evaluated 215 women with endometriosis and 210 with no evidence of the disease and reported significant difference between the prevalence of endometriosis and +405 G>C polymorphism (p = 0.002) in a way that the G allele frequency was 81.7% in rAFS stage III – IV endometriosis while it was 72.7% in the controls (5). In contrast, Kim et al. selected 215 women with an advanced stage of endometriosis as the case group, 219 women without endometriosis and 70 fertile women as the control group and showed that the frequency of +405 C/C genotype in patients with severe endometriosis was more than that of the control group (2). Similarly, Gentilini et al. examined 203 Italian women affected by endometriosis and 140 women without laparoscopic evidence of the disease and confirmed the possibility of endometriosis to be almost two times higher in patients carrying the C allele. Moreover, they showed that the existence of this allele could be a risk factor for the implantation of endometrial fragments which are refluxed into the peritoneal cavity (26). On the other hand, Awata et al. showed a high serum VEGF levels in healthy Japanese population with +405 C/C genotype distribution.

Our findings were not in lines with previously stated studies perhaps due to difference in geographical location or the genetic basis of the studied population, as the possibility of a disease occurrence depends on both its prevalence in the population and environmental factors (27). Race difference and genetic backgrounds are important factors in genetic association studies. Therefore selection of different control groups might lead to dissimilar results (27). For example, in the present study, the control group was comprised of women without the disease as confirmed by laparoscopy, while in a study on the Japanese population female neonates were selected as the control group (9). On the other hand, in a study carried out on the Korean population, the control group was made up of women who had either benign ovarian cysts, infertility, pelvic pain or dysmenorrhea (2).

Conclusion

In the present study, the genotype and allele distribution of the +405 C>G VEGF gene Polymorphism was not significantly different between the cases and the controls. However, further studies on larger Iranian populations may be necessary to confirm these observations.

Acknowledgement

The authors would like to thank Avicenna Research Institute for supporting this study, Mrs. Jamshidi and other operating room personnel of the Gynecological Surgery Ward at Tehran Clinic Hospital and also Mrs. Elham Savad Shirazi, Mrs. Bahareh Beik at Avicenna Infertility Clinic for help in collecting the study subjects.

References Olive DL Schwartz LB Endometriosis N Engl J Med. 1993 328 24 1759 69 Kim SH Choi YM Choung SH Jun JK Kim JG Moon SY Vascular endothelial growth factor gene +405 C/G polymorphism is associated with susceptibility to advanced stage endometriosis Hum Reprod. 2005 20 10 2904 8 Duignan NM Jordan JA Coughlan BM Logan-Edwards R One thousand consecutive cases of diagnostic laparoscopy J Obstet Gynaecol Br Commonw. 1972 79 11 1016 24 Williams TJ Pratt JH Endometriosis in 1,000 consecutive celiotomies: incidence and management Am J Obstet Gynecol. 1977 129 3 245 50 Bhanoori M Arvind Babu K Pavankumar Reddy NG Lakshmi Rao K Zondervan K Deenadayal M The vascular endothelial growth factor (VEGF) +405 G>C 5’-untranslated region Polymorphism and increased risk of endometriosis in South Indian women: a case control study Hum Reprod. 2005 20 7 1844 9 Taylor RN Lebovic DI Mueller MD Angiogenic factors in endometriosis Ann N Y Acad Sci. 2002 955 89 100 McLaren J Vascular endothelial growth factor and endometriotic angiogenesis Hum Reprod Update. 2000 6 1 45 55 Bourlev V Volkov N Pavlovitch S Lets N Larsson A Olovsson M The relationship between micro-vessel density, proliferative activity and expression of vascular endothelial growth factor-A and its receptors in eutopic endometrium and endometriotic lesions Reproduction. 2006 132 3 501 9 Ikuhashi Y Yoshida S Kennedy S Zondervan K Takemura N Deguchi M Vascular endothelial growth factor +936 C/T polymorphism is associated with an increased risk of endometriosis in a Japanese population Acta Obstet Gynecol Scand. 2007 86 11 1352 8 Hyder SM Nawaz Z Chiappetta C Stancel GM Identification of functional estrogen response elements in the gene coding for the potent angio-genic factor vascular endothelial growth factor Cancer Res. 2000 60 12 3183 90 Mueller MD Vigne JL Minchenko A Lebovic DI Leitman DC Taylor RN Regulation of vascular endothelial growth factor (VEGF) gene transcripttion by estrogen receptors alpha and beta Proc Natl Acad Sci U S A. 2000 97 20 10972 7 Donnez J Smoes P Gillerot S Casanas-Roux F Nisolle M Vascular endothelial growth factor (VEGF) in endometriosis Hum Reprod. 1998 13 6 1686 90 Tan XJ Lang JH Liu DY Shen K Leng JH Zhu L Expression of vascular endothelial growth factor and thrombospondin-1 mRNA in patients with endometriosis Fertil Steril. 2002 78 1 148 53 McLaren J Prentice A Charnock-Jones DS Millican SA Muller KH Sharkey AM Vascular endothelial growth factor is produced by peritoneal fluid macrophages in endometriosis and is regulated by ovarian steroids J Clin Invest. 1996 98 2 482 9 Matalliotakis IM Goumenou AG Koumantakis GE Neonaki MA Koumantakis EE Dionyssopoulou E Serum concentrations of growth factors in women with and without endometriosis: the action of anti-endometriosis medicines Int Immunopharmacol. 2003 3 1 81 9 Brogan IJ Khan N Isaac K Hutchinson JA Pravica V Hutchinson IV Novel polymorphisms in the promoter and 5’ UTR regions of the human vascular endothelial growth factor gene Hum Immunol. 1999 60 12 1245 9 Watson CJ Webb NJ Bottomley MJ Brenchley PE Identification of polymorphisms within the vascular endothelial growth factor (VEGF) gene: correlation with variation in VEGF protein production Cytokine. 2000 12 8 1232 5 Ray D Mishra M Ralph S Read I Davies R Brenchley P Association of the VEGF gene with proliferative diabetic retinopathy but not proteinuria in diabetes Diabetes. 2004 53 3 861 4 Lin CC Wu HC Tsai FJ Chen HY Chen WC Vascular endothelial growth factor gene-460 C/T polymorphism is a biomarker for prostate cancer Urology. 2003 62 2 374 7 Krippl P Langsenlehner U Renner W Yazdani-Biuki B Wolf G Wascher TC A common 936 C/T gene polymorphism of vascular endothelial growth factor is associated with decreased breast cancer risk Int J Cancer. 2003 106 4 468 71 Hsieh YY Chang CC Tsai FJ Yeh LS Lin CC Peng CT T allele for VEGF gene-460 Polymorphism at the 5’-untranslated region: association with a higher susceptibility to endometriosis J Reprod Med. 2004 49 6 468 72 Awata T Inoue K Kurihara S Ohkubo T Watanabe M Inukai K A common polymorphism in the 5’-untranslated region of the VEGF gene is associated with diabetic retinopathy in type 2 diabetes Diabetes. 2002 51 5 1635 9 Young HS Summers AM Bhushan M Brenchley PE Griffiths CE Single-nucleotide polymorphisms of vascular endothelial growth factor in psoriasis of early onset J Invest Dermatol. 2004 122 1 209 15 Vincenti V Cassano C Rocchi M Persico G Assignment of the vascular endothelial growth factor gene to human chromosome 6p21.3 Circulation. 1996 93 8 1493 5 Akiri G Nahari D Finkelstein Y Le SY Elroy-Stein O Levi BZ Regulation of vascular endothelial growth factor (VEGF) expression is mediated by internal initiation of translation and alternative initiation of transcription Oncogene. 1998 17 2 227 36 Gentilini D Somigliana E Vigano P Vignali M Busacca M Di Blasio AM The vascular endothelial growth factor +405 G>C polymorphism in endometriosis Hum Reprod. 2008 23 1 211 5 Zondervan KT Cardon LR Kennedy SH What makes a good case-control study? Design issues for complex traits such as endometriosis Hum Reprod. 2002 17 6 1415 23